bamtofastq

bedtools bamtofastq is a conversion utility for extracting FASTQ records from sequence alignments in BAM format.

Usage and option summary

Usage:

bedtools bamtofastq [OPTIONS] -i <BAM> -fq <FASTQ>

(or):

bamToFastq [OPTIONS] -i <BAM> -fq <FASTQ>
Option Description
-fq2 FASTQ for second end. Used if BAM contains paired-end data. BAM should be sorted by query name (samtools sort -n aln.bam aln.qsort) if creating paired FASTQ with this option.
-tags Create FASTQ based on the mate info in the BAM R2 and Q2 tags.

Default behavior

By default, each alignment in the BAM file is converted to a FASTQ record in the -fq file. The order of the records in the resulting FASTQ exactly follows the order of the records in the BAM input file.

$ bedtools bamtofastq -i NA18152.bam -fq NA18152.fq

$ head -8 NA18152.fq
@NA18152-SRR007381.35051
GGAGACATATCATATAAGTAATGCTAGGGTGAGTGGTAGGAAGTTTTTTCATAGGAGGTGTATGAGTTGGTCGTAGCGGAATCGGGGGTATGCTGTTCGAATTCATAAGAACAGGGAGGTTAGAAGTAGGGTCTTGGTGACAAAATATGTTGTATAGAGTTCAGGGGAGAGTGCGTCATATGTTGTTCCTAGGAAGATTGTAGTGGTGAGGGTGTTTATTATAATAATGTTTGTGTATTCGGCTATGAAGAATAGGGCGAAGGGGCCTGCGGCGTATTCGATGTTGAAGCCTGAGACTAGTTCGGACTCCCCTTCGGCAAGGTCGAA
+
<<<;;<;<;;<;;;;;;;;;;;;<<<:;;;;;;;;;;;;;;;;::::::;;;;<<;;;;;;;;;;;;;;;;;;;;;;;;;;;;<<<<<;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;<<;;;;;:;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;<<<;;;;;;;;;;<<<<<<<<;;;;;;;;;:;;;;;;;;;;;;;;;;;;;:;;;;8;;8888;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;8966689666666299866669:899
@NA18152-SRR007381.637219
AATGCTAGGGTGAGTGGTAGGAAGTTTTTTCATAGGAGGTGTATGAGTTGGTCGTAGCGGAATCGGGGGTATGCTGTTCGAATTCATAAGAACAGGGAGGTTAGAAGTAGGGTCTTGGTGACAAAATATGTTGTATAGAGTTCAGGGGAGAGTGCGTCATATGTTGTTCCTAGGAAGATTGTAGTGGTGAGGGTGTTTATTATAATAATGTTTGTGTATTCGGCTATGAAGAATAGGGCGAAGGGGCCTGCGGCGTATTCGATGTTGAAGCCTGAGACTAGTTCGGACTCCCCTTCCGGCAAGGTCGAA
+
<<<<<<<<<<;;<;<;;;;<<;<888888899<;;;;;;<;;;;;;;;;;;;;;;;;;;;;;;;<<<<<;;;;;;;;;<;<<<<<;;;;;;;;;;;;;<<<<;;;;;;;:::;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;<<<<;;;;;;;;;;;;;;;;;;;;;;;<;;;;;;;;;;;;;;;;;;;;;;<888<;<<;;;;<<<<<<;;;;;<<<<<<<<;;;;;;;;;:;;;;888888899:::;;8;;;;;;;;;;;;;;;;;;;99;;99666896666966666600;96666669966

-fq2 Creating two FASTQ files for paired-end sequences.

If your BAM alignments are from paired-end sequence data, one can use the -fq2 option to create two distinct FASTQ output files — one for end 1 and one for end 2.

Note

When using this option, it is required that the BAM file is sorted/grouped by the read name. This keeps the resulting records in the two output FASTQ files in the same order. One can sort the BAM file by query name with samtools sort -n aln.bam aln.qsort.

$ samtools sort -n aln.bam aln.qsort

$ bedtools bamtofastq -i aln.qsort.bam \
                      -fq aln.end1.fq \
                      -fq2 aln.end2.fq

$ head -8 aln.end1.fq
@SRR069529.2276/1
CAGGGAGAAGGAGGTAGGAAAGAGAAAGGACCAGGGAGGGGCGCATACACAGGACGCTCCGTGCGGTGATAGCAGCACCACACTGTGTTCAGTCGTCTGGC
+
=;@>==###############################################################################################
@SRR069529.2406/1
GCTGGGAAAAGGATTCAGGATGTTGGTTTCTATCTTTGAGTTGCTGCTGTGCGGCTGTCCCTACACTCGCAGTACCCCTCGGACACCGTCTACTGTGGAGG
+
=5@><<:?<?

$ head -8 aln.end2.fq
@SRR069529.2276/2
AGACCCAGAGAGGGACAGGATCTGTCCCAGATCATAAAATAGGGGGAGTGCTCCGTAGAGGCGTGCGCGGTGGCACCGTGCAGTAGTACGGGTGAGCGGGG
+
#####################################################################################################
@SRR069529.2406/2
TTCCCTACCCCTGGGGTCAGGGACTACAGCCAAGGGGAGAACTTTAGCAAGTAGACGTTAGTTATTTTGATTCCAGTGGGGACGCGCGTGTAGCGAGTTGT
+
@>=AABB?AAACABBA>@?AAAA>B@@AB@AA:B@AA@??#############################################################
comments powered by Disqus